shRNA載體質(zhì)粒plko.1 mannual

1、plko.1 trc cloning vectoraddgene plasmid 10878. protocol version 1.0. december 2006.copyright addgene 2006, all rights reserved. this protocol is provided for your convenience. see “warranty information” in appendix. table of contents a. plko.1-trc cloning vector a.1 the rnai consortium a.2 map of p

2、lko.1 a.3 related plasmids b. designing shrna oligos for plko.1 b.1 determine the optimal 21-mer targets in your gene b.2 order oligos compatible with plko.1 c. cloning shrna oligos into plko.1 c.1 recommended materials c.2 annealing oligos c.3 digesting plko.1 trc-cloning vector c.4 ligating and tr

3、ansforming into bacteria d. screening for inserts d.1 recommended materials d.2 screening for inserts e. producing lentiviral particles e.1 recommended materials e.2 protocol for producing lentiviral particles f. infecting target cells f.1 recommended materials f.2 determining the optimal puromycin

4、concentration f.3 protocol for lentiviral infection and selection g. safety h. references h.1 published articles h.2 web resources i. appendix i.1 sequence of plko.1 trc-cloning vector i.2 recipes i.3 warranty information back to topa. plko.1-trc cloning vectora.1 the rnai consortiumthe plko.1 cloni

5、ng vector is the backbone upon which the rnai consortium has built a library of shrnas directed against 15,000 human and 15,000 mouse genes. addgene is working with the trc to make this shrna cloning vector available to the scientific community. please cite moffat et al., cell 2006 mar; 124(6):1283-

6、98 (pubmed”:/pubmed/16564017?dopt=abstract) in all publications arising from the use of this vector.a.2 map of plko.1plko.1 is a replication-incompetent lentiviral vector chosen by the trc for expression of shrnas. plko.1 can be introduced into cells via direct transfection

7、, or can be converted into lentiviral particles for subsequent infection of a target cell line. once introduced, the puromycin resistance marker encoded in plko.1 allows for convenient stable selection. figure 1 : map of plko.1 containing an shrna insert. the original plko.1-trc cloning vector has a

8、 1.9kb stuffer that is released by digestion with agei and ecori. shrna oligos are cloned into the agei and ecori sites in place of the stuffer. the agei site is destroyed in most cases (depending on the target sequence), while the ecori site is preserved. for a complete map of plko.1 containing the

9、 1.9kb stuffer, visit /10878. descriptionvector element u6 human u6 promoter drives rna polymerase iii transcription for generation of shrna transcripts. cppt central polypurine tract, cppt, improves transduction efficiency by facilitating nuclear import of the vectors preintegration

10、complex in the transduced cells. hpgk human phosphoglycerate kinase promoter drives expression of puromycin. puro r puromycin resistance gene for selection of plko.1 plasmid in mammalian cells. sin 3ltr 3 self-inactivating long terminal repeat. f1 ori f1 bacterial origin of replication. amp r ampici

11、llin resistance gene for selection of plko.1 plasmid in bacterial cells puc ori puc bacterial origin of replication. 5ltr 5 long terminal repeat. rre rev response element. a.3 related productsthe following plasmids available from addgene are recommended for use in conjunction with the plko.1 trc-clo

12、ning vector. plasmid (addgene id #) description plko.1 trc control negative control vector containing non-hairpin insert. plko.1 scramble shrna negative control vector containing scrambled shrna. pspax2 packaging plasmid for producing viral particles. pmd2.g envelope plasmid for producing viral part

13、icles. note: plko.1 can also be used with packaging plasmid pcmv-dr8.2 dvpr and envelope plasmid pcmv-vsvg from robert weinbergs lab. for more information, visit addgenes mammalian rnai tools page.several other laboratories have deposited plko derived vectors that may also be useful for your experim

14、ent. to see these vectors, visit addgenes website and “search for “plko”“.back to topb. designing shrna oligos for plko.1b.1 determining the optimal 21-mer targets in your geneselection of suitable 21-mer targets in your gene is the first step toward efficient gene silencing. methods for target sele

15、ction are continuously being improved. below are suggestions for target selection.1. use an sirna selection tool to determine a set of top-scoring targets for your gene. for example, the whitehead institute for biomedical research hosts an sirna selection program that can be accessed after a free re

16、gistration (/bioc/sirnaext/). if you have macos x, another excellent program is irnai, which is provided free by the company mekentosj ( a summary of guidelines for designing sirnas with effective gene silencing is included here: starting at 25nt downstream of the start codon (a

17、tg), search for 21nt sequences that match the pattern aa(n 19 ). if no suitable match is found, search for nar(n 17 )ynn, where n is any nucleotide, r is a purine (a,g), and y is a pyrimidine (c,u). g-c content should be 36-52%. sense 3 end should have low stability at least one a or t between posit

18、ion 15-19. avoid targeting introns. avoid stretches of 4 or more nucleotide repeats, especially repeated ts because polyt is a termination signal for rna polymerase iii. 2. to minimize degradation of off-target mrnas, use ncbis blast program. select sequences that have at least 3 nucleotide mismatch

19、es to all unrelated genes. addgene recommends that you select multiple target sequences for each gene. some sequences will be more effective than others. in addition, demonstrating that two different shrnas that target the same gene can produce the same phenotype will alleviate concerns about off-ta

20、rget effects. b.2 ordering oligos compatible with plko.1to generate oligos for cloning into plko.1, insert your sense and antisense sequences from step b.1 into the oligos below. do not change the ends; these bases are important for cloning the oligos into the plko.1 trc-cloning vector.forward oligo

21、:5 ccgg21bp sensectcgag21bp antisensetttttg 3reverse oligo:5 aattcaaaaa21bp sensectcgag21bp antisense 3for example, if the target sequence is (aa)tgcctacgttaagctatac, the oligos would be:forward oligo: 5 ccgg aatgcctacgttaagctatac ctcgag gtatagcttaacgtaggcatt tttttg 3reverse oligo:5 aattcaaaaa aatgc

22、ctacgttaagctatac ctcgag gtatagcttaacgtaggcatt 3 back to topc. cloning oligos into plko.1the plko.1-trc cloning vector contains a 1.9kb stuffer that is released upon digestion with ecori and agei.the oligos from section b contain the shrna sequence flanked by sequences that are compatible with the st

23、icky ends of ecori and agei. forward and reverse oligos are annealed and ligated into the plko.1 vector, producing a final plasmid that expresses the shrna of interest.c.1 recommended materialsmaterial vendor and catalog # agei new england biolabs (neb) #r0552s ecori neb #r0101s t4 dna ligase neb #m

24、0202s neb buffer 2 neb #b7002s dh5 alpha competent cells invitrogen #18258-012 qiaquick gel extraction kit qiagen #28704 low melting point agarose sigma #a9414 luria broth agar (lb agar) american bioanalytical: #ab01200-02000 ampicillin vwr: #7177-48-2. use at 100 g/ml. carbenicillin vwr: #80030-956

25、. use at 100 g/ml. c.2 annealing oligos1. resuspend oligos in ddh2o to a concentration of 20 m, then mix:5 l forward oligo5 l reverse oligo5 l 10x neb buffer 235 l ddh2o2. incubate for 4 minutes at 95c in a pcr machine or in a beaker of boiling water.3. if using a pcr machine, incubate the sample at

26、 70c for 10 minutes then slowly cool to room temperature over the period of several hours. if using a beaker of water, remove the beaker from the flame, and allow the water to cool to room temperature. this will take a few hours, but it is important for the cooling to occur slowly for the oligos to

27、anneal. c.3 digesting plko.1 trc cloning vector1. digest plko.1 trc-cloning vector with agei. mix:6 g plko.1 trc-cloning vector (maxiprep or miniprep dna)5 l 10x neb buffer 11 l ageito 50 l ddh2o incubate at 37c for 2 hours. 2. purify with qiaquick gel extraction kit. elute in 30 l of ddh2o.3. diges

28、t eluate with ecori. mix:30 l plko.1 trc-cloning vector digested with agei5 l 10x neb buffer for ecori1 l ecori14 l ddh2o incubate at 37c for 2 hours. 4. run digested dna on 0.8% low melting point agarose gel until you can distinctly see 2 bands, one 7kb and one 1.9kb. cut out the 7kb band and place

29、 in a sterile microcentrifuge tube.when visualizing dna fragments to be used for ligation, use only long-wavelength uv light. short wavelength uv light will increase the chance of damaging the dna. 5. purify the dna using a qiaquick gel extraction kit. elute in 30 l of ddh2o.6. measure the dna conce

30、ntration. c.4 ligating and transforming into bacteria1. use your ligation method of choice. for a standard t4 ligation, mix:2 l annealed oligo from step c.2.20 ng digested plko.1 trc-cloning vector from step c.3. (if you were unable to measure the dna concentration, use 1 l)2 l 10x neb t4 dna ligase

31、 buffer1 l neb t4 dna ligaseto 20 l ddh2o incubate at 16c for 4-20 hours. 2. transform 2 l of ligation mix into 25 l competent dh5 alpha cells, following manufacturers protocol. plate on lb agar plates containing 100 g/ml ampicillin or carbenicillin (an ampicillin analog).back to topd. screening for

32、 insertsyou may screen for plasmids that were successfully ligated by restriction enzyme digestion. however, once you have identified the positive clones, it is important to verify the insert by conducting a sequencing reaction.d.1 recommended materialsmaterial vendor and catalog # dna miniprep kit

33、qiagen #27104 ecori neb #r0101s ncoi neb #r0193s agarose sigma #a9539 d.2 screening for insertsday 1:1. innoculate 5 colonies from each ligation into lb + 100 g/ml ampicillin or carbenicillin. day 2:2. spin down the cultures and use a miniprep kit to obtain dna.3. conduct a restriction digest with e

34、cori and ncoi: 1 g miniprep dna 2 l 10x neb buffer for ecori 0.8 l ecori 0.8 l ncoi to 20 l ddh2o incubate at 37c for 1-2 hours. 4. run the digestion products on a 1% agarose gel. you should see two fragments, a 2kb fragment and a 5kb fragment.5. sequence positive clones with plko.1 sequencing prime

35、r (5 caa ggc tgt tag aga gat aat tgg a 3).you may need to adjust the sequencing conditions if the dna polymerase has difficulty reading through the secondary structure of the hairpin sequence. back to tope. producing lentiviral particles before this step, you must contact your institutions bio-safet

36、y office to receive permission and institution-specific instructions. you must follow safety procedures and work in an environment (e.g. bl2+) suitable for handling hiv-derivative viruses.for transient knockdown of protein expression, you may transfect plasmid dna directly into the target cells. the

37、 shrna will be expressed, but the dna is unlikely to be integrated into the host genome.for stable loss-of-function experiments, addgene recommends that you generate lentiviral particles and infect the target cells. addition of puromycin will allow you to select for cells that stably express your sh

38、rna of interest. e.1 recommended materialsmaterial vendor and catalog # pspax2 addgene #12260 pmd2.g addgene #12259 hek-293t cells genhunter: #q401 fugene 6 transfection reagent roche applied biosciences: #11814443001 opti-mem serum-free media invitrogen: #31985 dulbeccos modified eagle medium (dmem

39、) invitrogen: #11995 fetal bovine serum (fbs) invitrogen: #16000 penicillin/streptomycin invitrogen: #15140-122 polypropylene tubes vwr: #87003-290 note: plko.1 could also be packaged using pcmv-dr8.2 dvpr and pcmv-vsvg from the robert weinberg lab. for more information, visit addgenes mammalian rna

40、i tools page.e.2 protocol for producing lentiviral particlesthis protocol is for transfection in a 6 cm plate. the protocol can be scaled to produce different amounts of virus as needed. day 1:a. for each plasmid to be transfected, plate 7105 hek-293t cells in 5 ml of media in a 6 cm tissue culture

41、plate. incubate cells at 37oc, 5% co2 overnight.although cells should regularly be passaged in dmem + 10% fbs with penicillin/streptomycin, cells should be plated at this step in dmem + 10% fbs without antibiotics (no penicillin or streptomycin). day 2:b. perform the transfection in the late afterno

42、on because the transfection mix should only be incubated with the cells for 12-15 hours.c. in polypropylene microfuge tubes (do not use polystyrene tubes), make a cocktail for each transfection: 1 g plko.1 shrna plasmid 750 ng pspax2 packaging plasmid 250 ng pmd2.g envelope plasmid to 20 l serum-fre

43、e opti-mem you may want to vary the ratio of shrna plasmid, packaging plasmid, and envelope plasmid to obtain the ratio that gives you the optimal viral production. d. create a master mix of fugene 6 transfection reagent in serum-free opti-mem. calculate the amount of fugene and opti-mem necessary g

44、iven that each reaction will require 6 l fugene + 74 l opti-mem. for example: 1x master mix: 6 l fugene + 74 l opti-mem 5x master mix: 30 l fugene + 370 l opti-mem 10x master mix: 60 l fugene + 740 l opti-mem in a polypropylene tube, add opti-mem first. pipette fugene directly into the opti-mem do n

45、ot allow fugene to come in contact with the walls of the tube before it has been diluted. mix by swirling or gently flicking the tube. incubate for 5 minutes at room temperature.e. add 80 l of fugene master mix to each tube from step c for a total volume of 100 l. pipette master mix directly into th

46、e liquid and not onto the walls of the tube. mix by swirling or gently flicking the tube.f. incubate for 20-30 minutes at room temperature.g. retrieve hek-293t cells from incubator. the cells should be 50-80% confluent and in dmem that does not contain antibiotics.h. without touching the sides of th

47、e dish, gently add dna:fugene mix dropwise to cells. swirl to disperse mixture evenly. do not pipette or swirl too vigorously, as you do not want to dislodge the cells from the plate.i. incubate cells at 37c, 5% co2 for 12-15 hours. day 3:j. in the morning, change the media to remove the transfectio

48、n reagent. replace with 5 ml fresh dmem + 10% fbs + penicillin/streptomycin. pipette the media onto the side of the plate so as not to disturb the transfected cells.k. incubate cells at 37c, 5% co2 for 24 hours. day 4:l. harvest media from cells and transfer to a polypropylene storage tube. the medi

49、a contains your lentiviral particles. store at 4c.m. add 5 ml of fresh media containing antibiotics to the cells and incubate at 37c, 5% co2 for 24 hours. day 5:n. harvest media from cells and pool with media from day 4. spin media at 1,250 rpm for 5 minutes to pellet any hek-293t cells that were in

50、advertently collected during harvesting.in lieu of centrifugation, you may filter the media through a 0.45 m filter to remove the cells. do not use a 0.2 m filter, as this is likely to shear the envelope of your virus. o. virus may be stored at 4c for a few days, but should be frozen at -20c or -80c

51、 for long-term storage.freeze/thaw cycles decrease the efficiency of the virus, so addgene recommends that you use the virus immediately or aliquot the media into smaller tubes to prevent multiple freeze/thaw cycles. back to topf. infecting target cellslentiviral particles can efficiently infect a b

52、road range of cell types, including both dividing and non-dividing cells. addition of puromycin will allow you to select for cells that are stably expressing your shrna of interest.f.1. recommended materialsmaterial vendor and catalog # hexadimethrine bromide (polybrene)* sigma-aldrich: #h9268 prota

53、mine sulfate* mp biomedicals: #194729 puromycin* sigma-aldrich: #p8833 target cells varies based on your experiment culture media for target cells varies based on your experiment materials for assay varies based on your experiment detailed protocols for preparing polybrene, protamine sulfate, and pu

54、romycin are located in the “appendix”. f.2. determining the optimal puromycin concentrationeach cell line responds differently to puromycin selection. addgene strongly recommends that you determine the optimal puromycin concentration for your cell line before initiating your experiment.day 1:a. plat

55、e target cells in ten 6 cm plates and grow at 37 c, 5% co2 overnight. day 2:b. the target cells should be approximately 80-90% confluent.c. dilute puromycin in the preferred culture media for your target cells. the final concentration of puromycin should be from 1-10 g/ml in 1 g/ml increments.d. label plates from 1-10 and add appropriate puromycin-containing media to cells.days 3+:e. examine cells each day and change to fresh puromycin-containing media every other day.f. the minimum concentration of puromycin that results in complete cell