1 tunel法檢測細胞凋亡detection of apoptosis during planarian regeneration and tunel assay_W

1、Gene 333 (2004) 15 25/locate/geneDetection of apoptosis during planarian regeneration by the expression of apoptosis-related genes and TUNEL assayJung Shan Hwanga, Chiyoko Kobayashib, Kiyokazu Agatab, Kazuho Ikeoa, Takashi Gojoboria,*a Center for Information Biology and DNA Data Bank

2、 of Japan, National Institute of Genetics, Yata 1111, Mishima, Shizuoka 411-8540, Japanb Laboratory for Evolutionary Regeneration Biology, Center for Developmental Biology, RIKEN Kobe, Kobe, Hyogo 650-0047, JapanReceived 10 July 2003; received in revised form 27 August 2003; accepted 5 February 2004

3、Available online 20 April 2004AbstractApoptosis is a tightly organized cell death process that plays a crucial role in metazoan development, but it has not yet been revealed whether apoptotic events are involved in the process of regeneration. Here, we tried to detect apoptotic cells during planaria

4、n regeneration using the TdT-mediated dUTP nick-end labeling (TUNEL) assay as well as the expression of apoptosis-related genes. Three novel cDNAs were isolated from a planarian cDNA library and shown to be closely related to other metazoan caspases at the amino acid sequence level. One of these cDN

5、As, Caspase-like gene 3 (DjClg3), was expressed primarily in apoptotic cells by double detections with the TUNEL assay. Whole mount in situ studies indicated that DjClg3 was expressed in the cells of the mesenchymal space and also around the pharynx of the intact body. Its expression in the regenera

6、ting head piece was seen in the blastema and less significantly in the brain, while in the regenerating tail piece, DjClg3 expression was detected uniformly throughout the entire region. In parallel experiments, we performed in situ TUNEL assays to localize the regions where cell death occurred duri

7、ng regeneration and comparable results to the DjClg3 expression patterns were obtained. This is the first report to show that planarians have apoptosis-related genes and the results suggest that the apoptotic mechanism probably takes place to a large extent in normal intact worms as well as during t

8、heir regeneration. We hypothesize that the presence of apoptosis in planarians may have a role in controlling cell numbers, eliminating unnecessary tissues or cells and remodeling the old tissues of regenerating body parts.D 2004 Elsevier B.V. All rights reserved.Keywords: Caspase; Programmed cell d

9、eath; Platyhelminthes; Blastema; Remodeling1. Introductioning mispatterning during development (Rusconi et al., 2000; Schaller et al., 2001). Obviously, this basic mechanism is highly conserved throughout metazoan evolution. The phe- nomenon of apoptosis has been observed in the develop- mental stag

10、es of many invertebrates such as Porifera, Cnidarian, Echinoderm, Nematoda and Arthropods (Wiens et al., 2000; Miller et al., 2000; Seipp et al., 2001; Voronina and Wessel, 2001; Metzstein et al., 1998; Richardson and Kumar, 2002; Brachmann and Cagan, 2003). Nevertheless, genes related to apoptosis

11、have so far only been identified and discussed extensively in C. elegans and Drosophila, and discussed to some extent in sponges (Wiens et al., 2000, 2003) and hydra (Cikala et al., 1999). The lack of informa- tion at the molecular level makes it difficult to study the mechanism of apoptosis, partic

12、ularly in the lower inverte- brates, with respect to their development.The freshwater flatworms, planarians, which belong to the phylum Platyhelminthes, are ideal animals for theApoptosis, or in a more general term, programmed cell death, has been known to play a fundamental role in the developmenta

13、l biology and embryogenesis of metazoans (Jacobson et al., 1997; Meier et al., 2000; Baehrecke, 2002). Apoptosis acts like a guardian which controls the precise number of cells for different types of organs or tissues and directs the morphological reorganization, avoid-Abbreviations: EST, expressed

14、sequence tag; RACE, rapid amplifica- tion of cDNA ends; TUNEL, TdT-mediated dUTP nick-end labeling; TdT, terminal deoxynucleotidyl transferase; NBT, 4-nitroblue tetrazolium chloride; BCIP, 5-bromo-4-chloro-3-indolyl-phosphate; DAPI, 4V,6-diami- dino-2-phenylindole; DAD-1, defender against cell death

15、 1; IAP-1, inhibitor of apoptosis protein 1; RNAi, RNA interference.+81-559-81-* Corresponding author. Tel.: +81-559-81-6847; fax: 6848.E-mail address: tgojoborgenes.nig.ac.jp (T. Gojobori).0378-1119/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2004.02.03416J.S.

16、Hwang et al. / Gene 333 (2004) 1525study of apoptosis in metazoan evolution since they are primitive organisms with a phylogenetic position near the base of the lineage of protostomes (Finnerty and Martin- dale, 1998; de Rose et al., 1999; Peterson et al., 2000; Peterson and Eernisse, 2001). Moreove

17、r, the regenerative ability of planarians is well known, in which blastema formation, cell differentiation, AP axial polarity and re- construction of lost parts are the central issues for many researchers (Agata and Watanabe, 1999; Newmark and Sanchez Alvarado, 2002; Agata et al., 2003). We believe

18、that apoptosis is definitely a key issue to the patterning of development and also in planarian regeneration. It is of particular interest to know whether the apoptosis possibly taking place in planarian regeneration has a sophisticated, comprehensive process that is well developed, like that seen i

19、n vertebrates.A set of expressed sequence tags (ESTs) data was constructed with a cDNA library derived from the head part of Dugesia japonica, which is a clonal strain propa- gating by asexual reproduction in the laboratory (Mineta et al., 2003). Using the ESTs data, we identified three apo- ptosis-

20、related cDNAs from an intact planarian cDNA li- brary and characterized their sequences by conducting homology searches and a phylogenetic analysis. In the second part of the paper, we examined the expression patterns of one of these three apoptosis-related genes at different stages of regeneration

21、and compared its expressionused for the PCR-based screening were derived from the EST database and their sequences were as follows:DjClg1/2F 5VCTGGGAGGCACTGATGATGCTGAT-CG 3V DjClg1/2R 5V ATTCTCCTCCACGACAAGCAGCTAC3V DjClg3F 5V GAAAATAAGAGTGCAGAGGCGATGG 3V DjClg3R 5V CCGTCAAACCCAGATCAGTCCGAAC 3VThe pl

22、aque lifting method was performed by screening the positive clones with DIG-labeled DNA probes accord- ing to the manufacturers instructions (Roche). DIG-la- beled DNA probes were generated by PCR using the same sets of primer pairs shown above. Isolated clones were inserted into the pTriplEx2 vecto

23、r (Clontech), sequenced on both strands using a Big-Dye Termination Kit (Perkin Elmer) and electrophorized using an automated ABI 377 sequencer.2.2.2. 5 VRACETo ensure the sequence at the 5V region of cDNA, 5VRACE was carried out using a 5V-Full RACE Core Set (Takara). The sequence 5V ACCATGAGACAGAA

24、TTATA- CAGACGAG 3V corresponding to LVCIILSHG was used as a universal primer to make the first strand cDNA of DjClg1, 2 and 3, and then the single stranded cDNA was circularized with T4 RNA ligase and amplified by two- round PCRs using three pairs of primers which were specific for each clone.patter

25、ns with the TUNEL-positive regions regenerating planarians.in intactand2.3. Sequence alignment and phylogenetic analysis2. Materials and methodsExcluding hypothetical proteins, 59 amino acid sequen- ces of the peptidase C14 (or large or ICE_p20) domain were obtained from the Pfam (St. Louis, version

26、 8.0).Regions outside of peptidase C14 show great sequence variation among species, especially in the N-terminal domain. With the addition of the three DjClg sequences, a total of 62 sequences of peptidase C14 were aligned using ClustalX, and the subsequent phylogenetic tree was viewed by TreeView.2

27、.1. Animals and regenerating bodiesThe asexual clonal strain, D. japonica,used inthisstudy was obtained from the Irima River, Gifu Prefecture,Japan. They were cultured in autoclaved tap water in the dark at 22 23 jC and fed once a week with chicken livers. To study planarian regeneration, animals ha

28、ving a length of6 8 mm were starved for at least 7 days before the amputation. Starved planarians were cut transversely at the postcephalic and postpharyngeal levels, and then left to regenerate without feeding (in autoclaved tap water at 22 23 jC).2.4. Preparation of tissue and cell samples2.4.1. D

29、issociated cellsThe protocol for obtaining dissociated cells was de- scribed in Asami et al. (2002). Briefly, planarians were cut into small pieces. The endogenous proteases were inacti- vated by 30 Ag/ml of trypsin inhibitor (Sigma) at RT for 10 min. Planarian fragments were further chopped, resus-

30、 pended in 0.25% trypsin (DIFCO), incubated at 20 jC for 1 h and then centrifuged at 4000 rpm for 2 min. The cell pellet was further dissociated by resuspension in 5/ 8 Holtfreter buffer. Dissociated cells were filtered through a 40 Am pore size filter, followed by fixation in 4% para- formaldehyde

31、at 4 jC for 30 min before spreading on a glass slide.2.2. Isolation and sequencing of DjClg1, 2 and 3 cDNAs2.2.1. Screening of a cDNA libraryAn intact planarian cDNA library was constructed according to the manufacturers protocol (SMART cDNA Library Construction Kit, Clontech). Caspase-like gene 1 (

32、DjClg1), 2 and 3 were isolated from the library using a PCR-based strategy (Bockmann et al., 1998) to minimize the labor cost, followed by the conventional plaque lifting method (Benton and David, 1977). The two primer pairsJ.S. Hwang et al. / Gene 333 (2004) 1525172.4.2. Paraffin sectionsParaffin s

33、ections for TUNEL and in situ hybridization were prepared as previously described by Kobayashi et al. (1998).2.8. In situ hybridization on paraffin sectionsIn situ hybridization on paraffin sections was carriedout as described by Kobayashi et al. (1998). The digox- igenin-labeled riboprobes used for

34、 the hybridization were the same as those used for the whole mount in situ hybridization.2.5. TUNEL reactionAll sample slides were pretreated before the TUNEL reaction. For dissociated cells, slides were incubated 0.1% Triton X-100 in 0.1% sodium citrate for 2 minin on2.9. RNA interferenceice, while

35、 for paraffin sections, slides were immersed in 0.1The construction of dsRNA and microinjection were performed as described in Cebria et al. (2002). Briefly, dsRNAs were constructed using the same plasmids used for making the riboprobes for the whole mount in situ hybrid- ization. Intact planarians

36、were injected with dsRNAs of DjClg1, DjClg2 and DjClg3 individually, and also a mix- ture of all three for three consecutive days. After injecting at the last day, a portion of the animals from each type of injection was amputated transversely at the postcephalicM citrate buffer (pH 6.0) and then mi

37、crowave-irradiated at 250 W for 5 min. Slides were pre-incubated in the terminal deoxynucleotidyl transferase (TdT) buffer (GIBCO BRL) at RT for 30 min and then incubated in the TUNEL reaction mix (In Situ Cell Death Detection Kit, AP., Roche) at 37 jC for 60 min. Following 3 washes in PBS buffer, s

38、lides were incubated with anti-fluorescein-AP (Roche) at 37 jC for 30 min and again rinsed three times in PBS buffer. The color was developed with phosphatase substrates, either 0.6 mg/ ml 4-nitroblue tetrazolium chloride (NBT) and 0.65 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) or Fast Red (

39、Roche) in 0.1 M Tris HCl, pH 8.2. For double detections, the first alkaline phosphatase was inactivated by two 15-min incubations in 0.1 M glycine HCl (pH 2.2), 0.1% Tween20 at RT before proceeding to the second detection.and postpharyngeal levels and then left at 22 23 jC regenerate.to3. Results3.1

40、. Identification and characterization of DjClg1, 2 and 32.6. In situ hybridization on dissociated cellsBased on sequences derived from the EST data (Mineta et al., 2003), two cDNA sequences possibly related to caspase were identified by homology searches. We then designed two primer pairs (DjClg1/2F

41、 and 1/2R; DjClg3F and 3R) and screened the full-length cDNA sequences from the intact planarian cDNA library using a combination of PCR and the plaque lifting method. Four and three positive clones were isolated using the DjClg1/2F and 1/2R primers, and DjClg3F and 3R primers, respectively. Sequenc

42、e anal- ysis of these clones revealed that, for the DjClg1/2F and 1/ 2R primer set, one exactly matched the cDNA sequence of the EST clone sequence while the other three showed a slightly different sequence, and thus we named them DjClg1 and DjClg2, respectively. For the DjClg3F and 3R primer set, a

43、ll three sequences were identical to the EST clone sequence and were named DjClg3. In summary, a total ofPrehybridization was carried out at 55 jC for at least 30 min. Cells were hybridized with a digoxigenin-labeled riboprobe at 55 jC for 24 h, followed by incubation with anti-digoxigenin-AP Fab fr

44、agment (Roche) according to the instructions provided with an ELFR 97 mRNA In situ Hybridization Kit (Molecular Probes). The color detection using the ELF kit was performed with a 1:100 dilution of the phosphatase substrate instead of the 10-fold dilution recommended by the kit manual. The substrate

45、 reaction was monitored under a fluorescent microscope and, in general, could be stopped after 10 15 min by rinsing with TE buffer.2.7. Whole mount in situ hybridizationthree different DjClNA clones were isolated in thisstudy. The 5V-end of each clone was further confirmed using 5VRACE.Whole mount i

46、n situ hybridizationwas performed asdescribed previously (Umesono et al., 1999). To make theantisense and sense riboprobes, full-length cDNAs of DjClg1, 2 and 3 isolated from the cDNA library were subcloned into pBluescript SK(+) (Stratagene). All anti- sense and sense RNA probes were labeled with d

47、igoxige- nin-UTP (Roche), and cleaned up using an RNeasy Mini Kit (QIAGEN). Approximately 100 pg/ml of an RNA probe was added to the hybridization reaction, and the hybridized RNA strands were detected by an AP-conjugated antidigox- igenin antibody and visualized by the addition of NBT/ BCIP substra

48、tes.The translated amino acid sequences of DjClg1, 2 and 3 are shown in Fig. 1A. All three DjClg clones isolated from the planarian either lack or carry a relatively short prodo- main sequence, giving predicted amino acid sequences of 261, 258 and 240 amino acids for DjClg1, 2 and 3, respectively. T

49、he prodomain is an amino-terminal domain that is present in all caspases but varies in size (Fig. 1A). The removal of the prodomain during an apoptotic event turns caspase into an active form, which subsequently carries out the proteolytic process. In addition, DjClg1, 218J.S. Hwang et al. / Gene 33

50、3 (2004) 1525Fig. 1. (A) DjClg1, 2 and 3 are aligned for amino acid sequence comparison. The number of amino acids is shown at the end of each sequence. Identical residues are typed in red. The putative Asp-X cleavage site that separates the large and small (ICE_p20 and ICE_p10, respectively) domain

51、s is marked by an asterisk. The residues conserved with other caspase families are shaded in blue and the two sequences of the large domain, LSHG and DACRG or DSKDN, which are conserved and critical in other caspases, are boxed. A schematic structure of caspase is shown above the amino acid sequence

52、s. Blocks represent the three basic domains of caspase, prodomain, ICE_p20 (large) and ICE_p10 (small). The prodomain can vary in size as illustrated by the broken line. Two conserved residue regions, LSHG and QAC(R/Q)G, are found in ICE_p20 and both histidine and cysteine (blue) are the important r

53、esidues for the catalytic activity of caspase. (B) An unrooted phylogenetic tree was inferred by the neighbor-joining method using only the peptidase C14 (or large or ICE_p20) domain sequences. DjClg1, 2 and 3 as well as caspases 3, 7 and 6 are circled. In addition to DjClg1, 2, and 3, the tree incl

54、udes amino acid sequences derived from humans, mice, rats, hamsters, chicken, Xenopus, zebrafish, medaka fish, fugu, Drosophila, nematodes and hydra.J.S. Hwang et al. / Gene 333 (2004) 152519and 3 share 37%, 32% and 28% amino acid sequence identities, respectively, to the ICE_p20 (or peptidase C14 o

55、r large) domain of human caspase 6. Examining two conserved regions of the caspase family, LSHG and QAC(R/Q)G, all DjClg contain the conserved LSHG but are only weakly similar to QAC(R/Q)G, especially DjClg3 (Fig. 1A). With the exception of the lack of the conserved residues QAC(R/Q)G, all other reg

56、ions of DjClg3 are very homologous to the caspase family. Moreover, a comparison of the nucleotide sequence of DjClg indicated that DjClg3 shared 63% and 71% nucleotide sequence homology, re- spectively, to DjClg1 and 2 (data not shown). Since DjClg3 lacks the conserved cysteine residue in QAC(R/Q)G

57、, DjClg3 could be devoid of cysteine protease activity. In fact, CASH (or MRIT or CLARP), identified as a caspase homologue that plays a critical role in apoptosis, was found to have a tyrosine instead of a cysteine in the conserved caspase active site QAC(R/Q)G (Goltsev et al., 1997; Han et al., 19

58、97; Inohara et al., 1997).The phylogenetic relationship of DjClg1, 2 and 3 to other known caspase families is shown in Fig. 1B. As a result, DjClg1, 2 and 3 were clustered with the caspase subfamily 3, 6 and 7, which are known to have a short prodomain,indicating they might have similarstructures to

59、 those ofeither caspase 3, 6 or 7. However, DjClg1, 2 and 3 seemed to be closer to each other than to any other caspases at the molecular level (Fig. 1B).3.2. Double detections showed coincidence of DjClg3 expression and cell deathTdT-mediated dUTP nick-end labeling (TUNEL) has been widely used to study cells undergoing DNA fragmen- tation during ap